MFF/mitochondrial fission factor cDNA ORF Clone, Human, C-OFPSpark® tag

1/1
Price:
Size:
Number:

MFF/mitochondrial fission factor cDNA ORF Clone, Human, C-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1404 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human mitochondrial fission factor.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+1.4kb)
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' ) BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MFF/mitochondrial fission factor cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

More Information About MFF/mitochondrial fission factor

Entrez Gene ID

MFF/mitochondrial fission factor cDNA ORF Clone, Human, C-OFPSpark® tag: Validated Images

MFF/mitochondrial fission factor cDNA ORF Clone, Human, C-OFPSpark® tag: Alternative Names

C2orf33 cDNA ORF Clone, Human; EMPF2 cDNA ORF Clone, Human; GL004 cDNA ORF Clone, Human

MFF/mitochondrial fission factor Background Information

Full Name
mitochondrial fission factor
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait