IkB alpha cDNA ORF Clone, Human, C-Myc tag

1/1
Price:
Size:
Number:

IkB alpha cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
999 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 81C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.0kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IkB alpha cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IkB alpha cDNA ORF Clone, Human, C-Myc tag: Validated Images

IkB alpha cDNA ORF Clone, Human, C-Myc tag: Alternative Names

IKBA cDNA ORF Clone, Human; MAD-3 cDNA ORF Clone, Human; NFKBI cDNA ORF Clone, Human

IkB alpha Background Information

Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IkB alpha, NFKBIA, or IKBA), is a member of the NF-kappa-B inhibitor family that function to inhibit the NF-kB transcription factor. NFKBIA inhibits NF-kB by masking the nuclear localization signals (NLS) of NF-kB proteins and keeping them sequestered in an inactive state in the cytoplasm. In addition, NFKBIA blocks the ability of NF-κB transcription factors to bind to DNA, which is required for NF-kB's proper functioning. Signal-induced degradation of I kappa B alpha exposes the nuclear localization signal of NF-kappa B, thus allowing it to translocate into the nucleus and activate transcription from responsive genes. An autoregulatory loop is established when NF-kappa B induces expression of the I kappa B alpha gene and newly synthesized I kappa B alpha accumulates in the nucleus where it negatively regulates NF-kappa B-dependent transcription. As part of this post-induction repression, the nuclear export signal on I kappa B alpha mediates transport of NF-kappa B-I kappa B alpha complexes from the nucleus to the cytoplasm. Deletion of NFKBIA has an effect that is similar to the effect of EGFR amplification in the pathogenesis of glioblastoma and is associated with comparatively short survival. Polymorphisms in NFKBIA may be important in pre-disposition to and outcome after treatment, of multiple myeloma (MM). The NFKBIA gene product, IkappaBalpha, binds to NF-kappaB preventing its activation and is important in mediating resistance to apoptosis in B-cell lymphoproliferative diseases.
Full Name
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
Research Areas
References
  • Verma IM, et al. (1995) Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev. 9 (22): 2723-35.
  • Jacobs MD, et al. (1998) Structure of an IkappaBalpha/NF-kappaB complex. Cell 95 (6): 749-58.
  • Hay RT, et al. (1999) Control of NF-kappa B transcriptional activation by signal induced proteolysis of I kappa B alpha. Philos Trans R Soc Lond B Biol Sci. 354(1389): 1601-9.
  • Spink CF, et al. (2007) Haplotypic structure across the I kappa B alpha gene (NFKBIA) and association with multiple myeloma. Cancer Lett. 246(1-2): 92-9.
  • Bredel M, et al. (2011) NFKBIA deletion in glioblastomas. N Engl J Med. 364(7): 627-37.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait