CSF3R/G-CSFR cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

CSF3R/G-CSFR cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2511 bp
Description
Full length Clone DNA of Human colony stimulating factor 3 receptor (granulocyte), transcript variant 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CSF3R/G-CSFR cDNA ORF Clone, Human, N-Myc tag: Alternative Names

CD114 cDNA ORF Clone, Human; CSF3R cDNA ORF Clone, Human; G-CSF R cDNA ORF Clone, Human; GCSFR cDNA ORF Clone, Human

CSF3R/G-CSFR Background Information

Granulocyte Colony Stimulating Factor Receptor (G-CSFR), also known as CD114, which belongs to the cytokine receptor superfamily, is a cell surface receptor for colony stimulating factor 3 (CSF3). It is a critical regulator of granulopoiesis. This type I membrane protein has a composite structure consisting of an immunoglobulin(Ig)-like domain, a cytokine receptor-homologous (CRH) domain and three fibronectin type III (FNIII) domains in the extracellular region. Mutations in the G-CSF receptor leading to carboxy-terminal truncation transduce hyperproliferative growth responses, and are implicated in the pathological progression of severe congenital neutropenia (SCN) to acute myelogenous leukemia (AML). Additionally, autocrine/paracrine stimulation of G-CSFR may be important in the biology of solid tumors, including metastasis.
Full Name
colony stimulating factor 3 receptor (granulocyte)
References
  • Kasper B, et al. (1999) Association of src-kinase Lyn and non-src-kinase Syk with the granulocyte colony-stimulating factor receptor (G-CSFR) is not abrogated in neutrophils from severe congenital neutropenia patients with point mutations in the G-CSFR mRNA. Int J Hematol. 70(4): 241-7.
  • Hollenstein U, et al. (2000) Endotoxin down-modulates granulocyte colony-stimulating factor receptor (CD114) on human neutrophils. J Infect Dis. 182(1): 343-6.
  • Kindwall-Keller TL, et al. (2008) Role of the proteasome in modulating native G-CSFR expression. Cytokine. 43(2): 114-23.
  • Beel K, et al. (2009) G-CSF receptor (CSF3R) mutations in X-linked neutropenia evolving to acute myeloid leukemia or myelodysplasia. Haematologica. 94(10): 1449-52.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait