pCMV3-N-FLAG Negative Control Vector (N-terminal FLAG-tagged)

  • Negative control for the pCMV3-N-FLAG clone.
  • Vector sequence is the same as pCMV3-N-FLAG, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV3-N-FLAG-NCV (Negative Control Vector) Physical Map
 
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV3-N-FLAG-NCV
 Vector Size

6013bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance

Kanamycin

 Selection In Mammalian Cells Hygromycin
 Protein Tag FLAG
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV3-N-FLAG-NCV (Negative Control Vector) Multiple Cloning Sites

  • Isobavachalcone isolated from Psoralea corylifolia inhibits cell proliferation and induces apoptosis via inhibiting the AKT/GSK-3β/β-catenin pathway in colorectal cancer cells
    Author
    Li, Y;Qin, X;Li, P;Zhang, H;Lin, T;Miao, Z;Ma, S;
    Year
    2019
    Journal
    Drug Des Devel Ther
  • Protein inhibitor of activated STAT1 (PIAS1) inhibits IRF8 activation of Epstein-Barr virus lytic gene expression
    Author
    Zhang, K;Lv, DW;Li, R;
    Year
    2019
    Journal
    Virology
    Application
    expression
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait