pCMV3-C-GFPSpark Control Vector (C-terminal GFPSpark-tagged)

  • Control for the pCMV3-C-GFPSpark clone.
  • Vector sequence is the same as pCMV3-C-GFPSpark, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
pCMV3-C-GFPSpark-CV (Control Vector) Physical Map
Vector Sequence
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope.
 Vector Name pCMV3-C-GFPSpark-CV
 Vector Size


 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag GFPSpark
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Schematic of pCMV3-C-GFPSpark-CV (Control Vector) Multiple Cloning Sites

  • ITGA2 is a target of miR-206 promoting cancer stemness and lung metastasis through enhanced ACLY and CCND1 expression in triple negative breast cancer
    Adorno-Cruz, V;Hoffmann, AD;Liu, X;Wray, B;Keri, RA;
  • IL-25 promotes cisplatin resistance of lung cancer cells by activating NF-κB signaling pathway to increase of major vault protein
    Shen, W;Qiu, Y;Li, J;Wu, C;Liu, Z;Zhang, X;Hu, X;Liao, Y;Wang, H;
    Cancer Med
  • Genetic risk of cholangiocarcinoma is linked to the autophagy gene ATG7
    Greer, SU;Ogmundsdottir, MH;Chen, J;Lau, BT;
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait