Encomenda rápida

Text Size:AAA

pCMV3-C-Myc Negative Control Vector (C-terminal Myc-tagged)

Folha de dadosAnálisesProdutos relacionadosProtocolos
  • Negative control for the pCMV3-C-Myc clone.
  • Vector sequence is the same as pCMV3-C-Myc, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
pCMV3-C-Myc-NCV (Negative Control Vector) Physical Map
Vector Sequence
 Vector Name pCMV3-C-Myc-NCV
 Vector Size


 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag Myc
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Schematic of pCMV3-C-Myc-NCV (Negative Control Vector) Multiple Cloning Sites

Size / Price
Catálogo: CV014
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade5 Business days
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.