TACI cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag tag

1/2
Price:
Size:
Number:

TACI cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
750 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse tumor necrosis factor receptor superfamily, member 13b with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.8kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

TACI cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TACI cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

TACI cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag tag: Alternative Names

1200009E08Rik cDNA ORF Clone, Mouse; Taci cDNA ORF Clone, Mouse

TACI Background Information

Tumor necrosis factor receptor superfamily, member 13B (TNFRSF13B) also known as Transmembrane activator and CAML interactor (TACI) and CD267 antigen, is a member of the tumor necrosis factor receptor superfamily. TNFRSF13B is a trimeric cytokine receptor that binds tumor necrosis factors (TNF). The receptor cooperates with an adaptor protein which is important in determining the outcome of the response. Members of the TNF receptor superfamily (TNFRSF) have crucial roles in both innate and adaptive immunity and in cellular apoptosis process. Apoptosis is a cell suicide mechanism that enables metazoans to control cell number in tissues and to eliminate individual cells that threaten the animal's survival. Certain cells have unique sensors, termed death receptors or tumour necrosis factor (TNFR), on their surface. Tumour necrosis factors (TNFR) detect the presence of extracellular death signals and, in response, they rapidly ignite the cell's intrinsic apoptosis machinery. TACI/TNFRSF13B/CD267 induces activation of the transcription factors NFAT, AP1, and NF-kappa-B and plays a crucial role in humoral immunity by interacting with a TNF ligand.
Full Name
tumor necrosis factor receptor superfamily, member 13B
References
  • Salzer U, et al. (2005) Mutations in TNFRSF13B encoding TACI are associated with common variable immunodeficiency in humans. Nat Genet. 37(8): 820-8.
  • Salzer U, et al. (2009) Relevance of biallelic versus monoallelic TNFRSF13B mutations in distinguishing disease-causing from risk-increasing TNFRSF13B variants in antibody deficiency syndromes. Blood. 113(9): 1967-76.
  • Mohammadi J, et al. (2009) Novel mutations in TACI (TNFRSF13B) causing common variable immunodeficiency. J Clin Immunol. 29(6): 777-85.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait