RSPO1 cDNA ORF Clone, Mouse, N-HA tag

1/1
Price:
Size:
Number:

RSPO1 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
798 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse R-spondin homolog (Xenopus laevis) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.83kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RSPO1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RSPO1 cDNA ORF Clone, Mouse, N-HA tag: Validated Images

RSPO1 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

R-spondin cDNA ORF Clone, Mouse; Rspondin cDNA ORF Clone, Mouse

RSPO1 Background Information

RSPO1 gene is a member of the R-spondin family. It encodes RSPO1 which is known as a secreted activator protein with two cystein-rich, furin-like domains and one thrombospondin type 1 domain. In mice, RSPO1 induces the rapid onset of crypt cell proliferation and increases intestinal epithelial healing, providing a protective effect against chemotherapy-induced adverse effects. This protein is an activator of the beta-catenin signaling cascade, leading to TCF-dependent gene activation. RSPO1 acts both in the canonical Wnt/beta-catenin-dependent pathway and in non-canonical Wnt signaling pathway, probably by acting as an inhibitor of ZNRF3, an important regulator of the Wnt signaling pathway. It also acts as a ligand for frizzled FZD8 and LRP6.
Full Name
R-spondin 1
References
  • Kamata T, et al. (2004) R-spondin, a novel gene with thrombospondin type 1 domain, was expressed in the dorsal neural tube and affected in Wnts mutants. Biochim Biophys Acta. 1676(1):51-62.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait