Encomenda rápida

Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem)

  • Human F10 / FX Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano F10 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1461bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens coagulation factor X.
Sinónimo de gene:F10, FX, FXA
Local de restrição:HindIII + XbaI (5.5kb + 1.46kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 792 C/T not causing the amino acid variation.
( We provide with F10 qPCR primers for gene expression analysis, HP100999 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano F10 Gene Plasmid Map
Human F10 / FX Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11076-ACG$225
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11076-ACR$225
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11076-ANG$225
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11076-ANR$225
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11076-CF$195
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11076-CH$195
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11076-CM$195
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11076-CY$195
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11076-G$75
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11076-G-N$195
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11076-NF$195
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11076-NH$195
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11076-NM$195
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11076-NY$195
Humano Coagulation Factor X/F10 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11076-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Coagulation factor X, also known as FX, F10, Eponym Stuart-Prower factor, and thrombokinase, is an enzyme of the coagulation cascade. It is one of the vitamin K-dependent serine proteases, and plays a crucial role in the coagulation cascade and blood clotting, as the first enzyme in the common pathway of thrombus formation. Factor X deficiency is one of the rarest of the inherited coagulation disorders. FX deficiency among the most severe of the rare coagulation defects, typically including hemarthroses, hematomas, and umbilical cord, gastrointestinal, and central nervous system bleeding. Factor X is synthesized in the liver as a mature heterodimer formed from a single-chain precursor, and vitamin K is essential for its synthesis. Factor X is activated into factor Xa (FXa) by both factor IX (with its cofactor, factor VIII in a complex known as intrinsic Xase) and factor VII (with its cofactor, tissue factor in a complex known as extrinsic Xase) through cleaving the activation propeptide. As the first member of the final common pathway or thrombin pathway, FXa converts prothrombin to thrombin in the presence of factor Va, Ca2+, and phospholipid during blood clotting and cleaves prothrombin in two places (an arg-thr and then an arg-ile bond). This process is optimized when factor Xa is complexed with activated cofactor V in the prothrombinase complex. Inborn deficiency of factor X is very uncommon, and may present with epistaxis (nose bleeds), hemarthrosis (bleeding into joints) and gastrointestinal blood loss. Apart from congenital deficiency, low factor X levels may occur occasionally in a number of disease states. Furhermore, factor X deficiency may be seen in amyloidosis, where factor X is adsorbed to the amyloid fibrils in the vasculature.

  • Rosen ED. (2002) Gene targeting in hemostasis. Factor X. Front Biosci. 7: d1915-25.
  • Uprichard J, et al. (2002) Factor X deficiency. Blood Rev. 16(2): 97-110.
  • Borensztajn K, et al. (2008) Factor Xa: at the crossroads between coagulation and signaling in physiology and disease. Trends Mol Med. 14(10): 429-40.
  • Menegatti M, et al. (2009) Factor X deficiency. Semin Thromb Hemost. 35(4): 407-15.
  • Size / Price
    Catálogo: HG11076-G-N
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.