EIF6 cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

EIF6 cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
738 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 6 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EIF6 cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

b(2)gcn cDNA ORF Clone, Human; CAB cDNA ORF Clone, Human; eIF-6 cDNA ORF Clone, Human; EIF3A cDNA ORF Clone, Human; ITGB4BP cDNA ORF Clone, Human; p27(BBP) cDNA ORF Clone, Human; p27BBP cDNA ORF Clone, Human

EIF6 Background Information

Full Name
eukaryotic translation initiation factor 6
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait