Encomenda rápida

Mouse SPP1 ORF mammalian expression plasmid, N-HA tag

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse SPP1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_009263.2
Tamanho de cDNA:885bp
Descrição de cDNA:Full length Clone DNA of Mus musculus secreted phosphoprotein 1 with C terminal HA tag.
Sinónimo de gene:OP, Bsp, Eta, Opn, Ric, BNSP, BSPI, Opnl, Apl-1, ETA-1, Spp-1, AA960535, AI790405, minopontin
Espécie:Mouse
Vetor:pCMV3-SP-N-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fundo

Osteopontin, also known as Secreted phosphoprotein 1, Bone sialoprotein 1, BSP-1, OPN, and SPP1, is a member of the osteopontin family and a SIBLING glycoprotein. Osteopontin has been classified as T-helper 1 cytokine and thus believed to exacerbate inflammation in several chronic inflammatory diseases, including atherosclerosis. Besides proinflammatory functions, physiologically Osteopontin is a potent inhibitor of mineralization, it prevents ectopic calcium deposits and is a potent inducible inhibitor of vascular calcification. Osteopontin is expressed and secreted by various cells, and has a role in cell adhesion, chemotaxis, prevention of apoptosis, invasion, migration and anchorage-independent growth of tumor cells. Osteopontin recruitment functions of inflammatory cells are thought to be mediated through its adhesive domains, especially the arginine-glycine-aspartate (RGD) sequence that interacts with several integrin heterodimers. Osteopontin has emerged as a potential biomarker and mediator in cardiovascular disease. In the context of atherosclerosis, OPN is generally regarded as a proinflammatory and proatherogenic molecule. However, the role of OPN in vascular calcification (VC), which is closely related to chronic and active inflammation, is that of a negative regulator because it is an inhibitor of calcification and an active inducer of decalcification. Extensive research has demonstrated the pivotal participation of Osteopontin in the regulation of cell signaling which controls neoplastic and malignant transformation. The elevated expression of Osteopontin has been observed in a variety of cancers. It has been linked with tumor metastasis and signifies a poor prognosis for the patient.

Referências
  • Scatena M, et al. (2007) Osteopontin: a multifunctional molecule regulating chronic inflammation and vascular disease. Arterioscler Thromb Vasc Biol. 27(11): 2302-9.
  • Johnston NI, et al. (2008) Osteopontin as a target for cancer therapy. Front Biosci. 13: 4361-72.
  • Cho HJ, et al. (2009) Osteopontin: a multifunctional protein at the crossroads of inflammation, atherosclerosis, and vascular calcification. Curr Atheroscler Rep. 11(3): 206-13.
  • Waller AH, et al. (2010) Osteopontin in cardiovascular disease: a potential therapeutic target. Cardiol Rev. 18(3): 125-31.
  • Shevde LA, et al. (2010) Osteopontin: an effector and an effect of tumor metastasis. Curr Mol Med. 10(1): 71-81.
  • Size / Price
    Catálogo: MG50116-NY
    Preço de catálogo:   (Save )
    Preço:      [How to order]
    Disponibilidade2-3 weeksInstruções de envio
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"