RPL15 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

RPL15 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
615 bp
Description
Full length Clone DNA of Human ribosomal protein L15 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RPL15 cDNA ORF Clone, Human, C-HA tag: Alternative Names

DBA12 cDNA ORF Clone, Human; EC45 cDNA ORF Clone, Human; L15 cDNA ORF Clone, Human; RPL10 cDNA ORF Clone, Human; RPLY10 cDNA ORF Clone, Human; RPYL10 cDNA ORF Clone, Human

RPL15 Background Information

Full Name
ribosomal protein L15

RPL15 cDNA ORF Clone, Canine, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait