Sino Biological - Official Website

PSG1 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

PSG1 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1260 bp
Description
Full length Clone DNA of Human pregnancy specific beta-1-glycoprotein 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PSG1 cDNA ORF Clone, Human, C-HA tag: Alternative Names

B1G1 cDNA ORF Clone, Human; CD66f cDNA ORF Clone, Human; DHFRP2 cDNA ORF Clone, Human; FL-NCA-1/2 cDNA ORF Clone, Human; PBG1 cDNA ORF Clone, Human; PS-beta-C/D cDNA ORF Clone, Human; PS-beta-G-1 cDNA ORF Clone, Human; PSBG-1 cDNA ORF Clone, Human; PSBG1 cDNA ORF Clone, Human; PSG95 cDNA ORF Clone, Human; PSGGA cDNA ORF Clone, Human; PSGIIA cDNA ORF Clone, Human; SP1 cDNA ORF Clone, Human

PSG1 Background Information

Pregnancy-specific glycoproteins (PSGs) are a family of Ig-like proteins secreted by specialized placental cells. The PSG1 structure is composed of a single Ig variable region-like N-terminal domain and three Ig constant region-like domains termed A1, A2, and B2. Members of the human and murine PSG family have been shown to induce anti-inflammatory cytokines from monocytes and macrophages and to stimulate angiogenesis.Two distinct domains of PSG1 are involved in the regulation of TGF-beta1 and provide a mechanistic framework for how PSGs modulate the immunoregulatory environment at the maternal-fetal interface for successful pregnancy outcome.
Full Name
pregnancy specific beta-1-glycoprotein 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait