LSD1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

1/2
Price:
Size:
Number:

LSD1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2559 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human lysine (K)-specific demethylase 1A with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 2.61kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

LSD1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

More Information About LSD1

Entrez Gene ID

LSD1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

LSD1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Alternative Names

AOF2 cDNA ORF Clone, Human; BHC110 cDNA ORF Clone, Human; KDM1 cDNA ORF Clone, Human; LSD1 cDNA ORF Clone, Human

LSD1 Background Information

LSD1 belongs to the flavin monoamine oxidase family. It contains 1 SWIRM domain and is a component of a RCOR/GFI/LSD1/HDAC complex. LSD1 interacts directly with GFI1 and GFI1B. LSD1 speficially removes histone H3K4me2 to H3K4me1 or H3K4me through a FAD-dependent oxidative reaction. When forming a complex with androgen receptor (and possibly other nuclear hormone receptors), LSD1 changes its substrates to H3K9me2. Thus LSD1 is considered to act as a coactivator or a corepressor. It may play a role in the repression of neuronal genes. Alone, LSD1 is unable to demethylate H3 'Lys-4' on nucleosomes and requires the presence of RCOR1/CoREST to achieve such activity.
Full Name
lysine (K)-specific demethylase 1A
References
  • Kusaba M, et al. (2007) Rice NON-YELLOW COLORING1 is involved in light-harvesting complex II and grana degradation during leaf senescence. Plant Cell. 19(4):1362-75.
  • Pazour GJ, et al. (2005) Proteomic analysis of a eukaryotic cilium. J Cell Biol. 170(1):103-13.
  • Merchant SS, et al. (2007) The Chlamydomonas genome reveals the evolution of key animal and plant functions. Science. 318(5848):245-50.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait