Sino Biological - Official Website

pCMV3-C-HA Negative Control Vector (C-terminal HA-tagged)

  • Negative control for the pCMV3-C-HA clone.
  • Vector sequence is the same as pCMV3-C-HA, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
pCMV3-C-HA-NCV (Negative Control Vector) Physical Map
Vector Sequence
 Vector Name pCMV3-C-HA-NCV
 Vector Size


 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag HA
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Schematic of pCMV3-C-HA-NCV (Negative Control Vector) Multiple Cloning Sites

  • Mitochondrial methionine sulfoxide reductase B2 links oxidative stress to Alzheimer's disease-like pathology
    Xiang, XJ;Song, L;Deng, XJ;Tang, Y;Min, Z;Luo, B;Wen, QX;Li, KY;Chen, J;Ma, YL;Zhu, BL;Yan, Z;Chen, GJ;
    Exp. Neurol.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait