Sino Biological - Official Website

pCMV3-C-FLAG Negative Control Vector (C-terminal FLAG-tagged)

  • Negative control for the pCMV3-C-FLAG clone.
  • Vector sequence is the same as pCMV3-C-FLAG, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV3-C-FLAG-NCV (Negative Control Vector) Physical Map
 
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV3-C-FLAG-NCV
 Vector Size

5953bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag FLAG
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV3-C-FLAG-NCV (Negative Control Vector) Multiple Cloning Sites

  • A viral microRNA downregulates metastasis suppressor CD82 and induces cell invasion and angiogenesis by activating the c-Met signaling
    Author
    Li, W;Hu, M;Wang, C;Lu, H;Chen, F;Xu, J;Shang, Y;Wang, F;Qin, J;Yan, Q;Krueger, BJ;Renne, R;Gao, SJ;Lu, C;
    Year
    2017
    Journal
    Oncogene
  • Collagen type II suppresses articular chondrocyte hypertrophy and osteoarthritis progression by promoting integrin β1-SMAD1 interaction
    Author
    Lian, C;Wang, X;Qiu, X;Wu, Z;Gao, B;Liu, L;Liang, G;Zhou, H;Yang, X;Peng, Y;Liang, A;Xu, C;Huang, D;Su, P;
    Year
    2019
    Journal
    Bone Res
    Application
    expression
  • The X-Linked DDX3X RNA Helicase Dictates Translation Reprogramming and Metastasis in Melanoma
    Author
    Phung, B;Cieśla, M;Sanna, A;Guzzi, N;Beneventi, G;Cao Thi Ngoc, P;Lauss, M;Cabrita, R;Cordero, E;Bosch, A;Rosengren, F;Häkkinen, J;Griewank, K;Paschen, A;Harbst, K;Olsson, H;Ingvar, C;Carneiro, A;Tsao, H;Schadendorf, D;Pietras, K;Bellodi, C;Jönsson, G;
    Year
    2019
    Journal
    Cell Rep
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait