After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao VEGFC/VEGF-C/Flt4-L clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse VEGF-C Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:
Tamanho de cDNA:
Descrição de cDNA:
Sinónimo de gene:
Espécie:Mouse
Vetor:
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Armazenamento:
Mouse VEGF-C Gene Plasmid Map
Mouse VEGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Ratazanao VEGFC/VEGF-C/Flt4-L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50391-ACG$225
Ratazanao VEGFC/VEGF-C/Flt4-L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50391-ACR$225
Ratazanao VEGFC/VEGF-C/Flt4-L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50391-CF$195
Ratazanao VEGFC/VEGF-C/Flt4-L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50391-CH$195
Ratazanao VEGFC/VEGF-C/Flt4-L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50391-CM$195
Ratazanao VEGFC/VEGF-C/Flt4-L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50391-CY$195
Ratazanao VEGFC/VEGF-C/Flt4-L clonagem de ADN ou de clonagem do gene (vector de expressão)MG50391-M$75
Ratazanao VEGFC/VEGF-C/Flt4-L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50391-M-H$195
Ratazanao VEGFC/VEGF-C/Flt4-L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50391-NF$195
Ratazanao VEGFC/VEGF-C/Flt4-L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50391-NH$195
Ratazanao VEGFC/VEGF-C/Flt4-L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50391-NM$195
Ratazanao VEGFC/VEGF-C/Flt4-L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50391-NY$195
Ratazanao VEGFC/VEGF-C/Flt4-L clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50391-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Vascular endothelial growth factor C (VEGF-C) is a member of the VEGF family. Upon biosynthesis, VEGF-C protein is secreted as a non-covalent momodimer in an anti-parellel fashion. VEGF-C protein is a dimeric glycoprotein, as a ligand for two receptors, VEGFR-3 (Flt4), and VEGFR-2. VEGF-C may function in angiogenesis of the venous and lymphatic vascular systems during embryogenesis. VEGF-C protein is over-expressed in various human cancers including breast cancer and prostate cancer. VEGF-C/VEGFR-3 axis, through different signaling pathways, plays a critical role in cancer progression by regulating different cellular functions, such as invasion, proliferation, and resistance to chemotherapy. Thus, targeting the VEGF-C/VEGFR-3 axis may be therapeutically significant for certain types of tumors.

Referências
  • Joukov V, et al. (1997) Vascular endothelial growth factors VEGF-B and VEGF-C. J Cell Physiol. 173(2): 211-5.
  • Su JL, et al. (2007) The role of the VEGF-C/VEGFR-3 axis in cancer progression. Br J Cancer. 96(4): 541-5.
  • Anisimov A, et al. (2009) Activated forms of VEGF-C and VEGF-D provide improved vascular function in skeletal muscle. Circ Res. 104(11): 1302-12.
  • Contact Us
    Imagens
    • Mouse VEGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"