Encomenda rápida

Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano SERPINA4 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:
Descrição de cDNA:
Sinónimo de gene:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.