APEG1 cDNA ORF Clone, Human, untagged

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

APEG1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
342 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SPEG complex locus.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI (5.5kb + 0.34kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

APEG1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

APEG1 cDNA ORF Clone, Human, untagged: Validated Images

APEG1 cDNA ORF Clone, Human, untagged: Alternative Names

APEG-1 cDNA ORF Clone, Human; APEG1 cDNA ORF Clone, Human; BPEG cDNA ORF Clone, Human; CNM5 cDNA ORF Clone, Human; SPEGalpha cDNA ORF Clone, Human; SPEGbeta cDNA ORF Clone, Human

APEG1 Background Information

Striated muscle preferentially expressed protein kinase, also known as aortic preferentially expressed protein 1, APEG-1, SPEG and KIAA1297, is a protein which belongs to theprotein kinase superfamily and CAMK Ser/Thr protein kinase family. SPEG / APEG-1 contains twofibronectin type-III domains, nine Ig-like (immunoglobulin-like) domains, two protein kinase domains. Isoform1of SPEG is preferentially expressed in striated muscle. Non-kinase form such as isoform3of SPEG is predominantly expressed in the aorta. Isoform3of SPEG appears to be expressed only in highly differentiated ASMC in normal vessel walls and down-regulated in dedifferentiated ASMC. Isoform3of SPEG may have a role in regulating the growth and differentiation of arterial smooth muscle cells. Isoform3of SPEG is quickly down-regulated in response to vascular injury, when ASMC cells change from a quiescent to a proliferative phenotype.
Full Name
SPEG complex locus
References
  • Hsieh C.-M., et al., 1996, J. Biol. Chem. 271:17354-17359.
  • Manjasetty B.A., et al., 2005, BMC Struct. Biol. 5:21-21.
  • Zhou,Y. et al., 2007, Anal Chem. 79 (15): 5826-37.
  • Greenman C., et al., 2007, Nature. 446:153-158.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait