Encomenda rápida

Text Size:AAA

Ratazana OX-40L / TNFSF4 / CD252 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat TNFSF4 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:600bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus tumor necrosis factor (ligand) superfamily, member 4 with N terminal Flag tag.
Sinónimo de gene:Ox40l, Txgp1, Tnfsf4
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazana OX-40L / TNFSF4 / CD252 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Product nameProduct name

OX-40L, also known as TNFSF4 and CD252, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. OX-40L is an important costimulatory molecule that plays a crucial role in the regulation of T-cell-mediated immunity. The interaction of TNFSF4-TNFSF4 is involved in the pathogenesis of multiple autoimmune and inflammatory diseases such as systemic lupus erythematosus (SLE), carotid artery disease and cancer. OX-40L is a ligand for receptor TNFRSF4/OX4. It is found to play a role in T cell antigen-presenting cell (APC) interactions. In surface Ig- and CD40-stimulated B cells, this cytokine along with CD70 has been shown to provide CD28-independent costimulatory signals to T cells. This protein and its receptor are reported to directly mediate adhesion of activated T cells to vascular endothelial cells.

  • Lei W. et al., 2012, Ann Acad Med Singapore. 41 (5): 200-4.
  • Lee YH. et al., 2012, Hum Immunol. 73 (10): 1050-4.
  • Weiguang Y. et al., 2012, PLoS One. 7 (8): e41277.
  • Size / Price
    Catálogo: RG80146-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.