Encomenda rápida

Ratazana TNFSF12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat TNFSF12 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:750bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus tumor necrosis factor ligand superfamily member 12 with N terminal Flag tag.
Sinónimo de gene:TWEAK, Prmt2, Tnfsf12
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

TNFSF12 is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. It is a ligand for the FN14/TWEAKR receptor. TNFSF12 has overlapping signaling functions with TNF, but displays a much wider tissue distribution. It can induce apoptosis via multiple pathways of cell death in a cell type-specific manner. It is also found that TNFSF12 promotes proliferation and migration of endothelial cells, and thus acts as a regulator of angiogenesis. TNFSF12 also is a weak inducer of apoptosis in some cell types and mediates NF-kappa-B activation.

  • Wiley SR, et al. (2004) TWEAK, a member of the TNF superfamily, is a multifunctional cytokine that binds the TweakR/Fn14 receptor. Cytokine Growth Factor Rev. 14(3-4):241-9.
  • Campbell S, et al. (2006) The role of TWEAK/Fn14 in the pathogenesis of inflammation and systemic autoimmunity. Front Biosci. 9:2273-84.
  • Lynch CN, et al. (1999) TWEAK induces angiogenesis and proliferation of endothelial cells. J Biol Chem. 274(13):8455-9.
  • Size / Price
    Catálogo: RG80154-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.