Encomenda rápida

Text Size:AAA

Ratazana TNFRSF21/DR6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat TNFRSF21 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1968bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus tumor necrosis factor receptor superfamily, member 21 with N terminal Flag tag.
Sinónimo de gene:Tnfrsf21
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

TNFRSF21 (death receptor-6, DR6) is an orphan TNF receptor superfamily member and belongs to a subgroup of receptors called death receptors. This type I transmembrane receptor possesses four extracellular cysteine-rich motifs and a cytoplasmic death domain. DR6 is an extensively posttranslationally modified transmembrane protein and that N- and O-glycosylations of amino acids in its extracellular part. DR6 interacts with the adaptor protein TRADD and mediates signal transduction through its death domain, and expression of DR6 in mammalian cells induces activation of both NF-kappaB and JNK and cell apoptosis. DR6 knockout mice have enhanced CD4+ T cell proliferation and Th2 cytokine production, suggested that DR6 serves as an important regulatory molecule in T-helper cell activation, and is involved in inflammation and immune regulation. DR6 is expressed ubiquitously with high expression in lymphoid organs, heart, brain and pancreas. Some tumor cells overexpress DR6, typically in conjunction with elevated anti-apoptosis molecules. DR6 may also be involved in tumor cell survival and immune evasion, which is subject to future investigations.

  • Pan G, et al. (1998) Identification and functional characterization of DR6, a novel death domain-containing TNF receptor. FEBS Lett. 431(3): 351-6.
  • Benschop R, et al. (2009) Tumor necrosis factor receptor superfamily member 21: TNFR-related death receptor-6, DR6. Adv Exp Med Biol. 647: 186-94.
  • Klma M, et al. (2009) Functional analysis of the posttranslational modifications of the death receptor 6. Biochim Biophys Acta. 1793(10): 1579-87.
  • Size / Price
    Catálogo: RG80155-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.