After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana TNFRSF11A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat TNFRSF11A Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001271235.1
Tamanho de cDNA:1902bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus Tumor necrosis factor receptor superfamily, member 11a with N terminal Flag tag.
Sinónimo de gene:RGD1563614, Tnfrsf11a
Espécie:Rat
Vetor:pCMV3-SP-N-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fundo

TNFRSF11A is a member of the TNF-receptor superfamily. In mouse, it is also known as CD265. TNFRSF11A contains 4 TNFR-Cys repeats and is widely expressed with high levels in skeletal muscle, thymus, liver, colon, small intestine and adrenal gland. It is an essential mediator for osteoclast and lymph node development. TNFRSF11A and its ligand are important regulators of the interaction between T cells and dendritic cells. It can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. Defects in TNFRSF11A can cause familial expansile osteolysis (FEO). FEO is a rare autosomal dominant bone disorder characterized by focal areas of increased bone remodeling. Defects in TNFRSF11A also can cause Paget disease of bone type 2 (PDB2). PDB2 is a bone-remodeling disorder with clinical similarities to FEO. Defects in TNFRSF11A are the cause of osteopetrosis autosomal recessive type 7 which characterized by abnormally dense bone, due to defective resorption of immature bone.

Referências
  • Darnay B G, et al. (1998) Characterization of the intracellular domain of receptor activator of NF-kappaB (RANK). Interaction with tumor necrosis factor receptor-associated factors and activation of NF-kappab and c-Jun N-terminal kinase. J Biol Chem. 273(32):20551-5.
  • Darnay B G, et al. (1999) Activation of NF-kappaB by RANK requires tumor necrosis factor receptor-associated factor (TRAF) 6 and NF-kappaB-inducing kinase. Identification of a novel TRAF6 interaction motif. J Biol Chem. 274(12):7724-31.
  • Galibert L, et al. (1998) The involvement of multiple tumor necrosis factor receptor (TNFR)-associated factors in the signaling mechanisms of receptor activator of NF-kappaB, a member of the TNFR superfamily. J Biol Chem. 273(51):34120-7.
  • Size / Price
    Catálogo: RG80160-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"