TMEM167A cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81098-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All TMEM167A Reagents

CRO Services

Product recommended


All TMEM167A Reagents

TMEM167A cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
219 bp
Description
Full length Clone DNA of Rat transmembrane protein 167A with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM167A Background Information

Full Name
transmembrane protein 167A

TMEM167A cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
TMEM167A cDNA ORF Clone in Cloning Vector, Rabbit TG65020-G
TMEM167A cDNA ORF Clone, Rabbit, untagged TG65020-UT
TMEM167A Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65020-ACGLN
TMEM167A cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65020-ACG
TMEM167A cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65020-ACR
TMEM167A cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65020-CF
TMEM167A cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65020-NF
TMEM167A cDNA ORF Clone, Rabbit, C-His tag TG65020-CH
TMEM167A cDNA ORF Clone, Rabbit, N-His tag TG65020-NH
TMEM167A cDNA ORF Clone, Rabbit, C-HA tag TG65020-CY
TMEM167A cDNA ORF Clone, Rabbit, N-HA tag TG65020-NY
TMEM167A cDNA ORF Clone, Rabbit, C-Myc tag TG65020-CM
TMEM167A cDNA ORF Clone, Rabbit, N-Myc tag TG65020-NM

TMEM167A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMEM167A cDNA ORF Clone in Cloning Vector, Rat RG81098-U
TMEM167A cDNA ORF Clone, Rat, untagged RG81098-UT
TMEM167A cDNA ORF Clone, Rat, C-GFPSpark® tag RG81098-ACG
TMEM167A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81098-ACGLN
TMEM167A cDNA ORF Clone, Rat, C-OFPSpark® tag RG81098-ACR
TMEM167A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81098-NF
TMEM167A cDNA ORF Clone, Rat, C-His tag RG81098-CH
TMEM167A cDNA ORF Clone, Rat, N-His tag RG81098-NH
TMEM167A cDNA ORF Clone, Rat, C-HA tag RG81098-CY
TMEM167A cDNA ORF Clone, Rat, N-HA tag RG81098-NY
TMEM167A cDNA ORF Clone, Rat, C-Myc tag RG81098-CM
TMEM167A cDNA ORF Clone, Rat, N-Myc tag RG81098-NM
TMEM167A qPCR Primer Pairs, Rat RP301055

TMEM167A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM167A cDNA ORF Clone in Cloning Vector, Human HG26116-U
info info
添加购物车成功! 添加购物车失败!