Encomenda rápida

Ratazana Thrombomodulin / THBD clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Ratazana THBD Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_031771.2
    Tamanho de cDNA:1734bp
    Descrição de cDNA:Full length Clone DNA of Rattus norvegicus thrombomodulin with C terminal HA tag.
    Sinónimo de gene:Thbd
    Espécie:Rat
    Vetor:pCMV3-C-HA
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with THBD qPCR primers for gene expression analysis, RP300318 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Ratazana Thrombomodulin / THBD clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
    Product nameProduct name
    Fundo

    Thrombomodulin, also known as THBD(CD141), is an integral membrane protein which reduces blood coagulation by converting thrombin to an anticoagulant enzyme from a procoagulant enzyme. Thrombomodulin is expressed on the surface of endothelial cells and serves as a cofactor for thrombin. It is also expressed on human mesothelial cell, monocyte and a dendritic cell subset. Thrombomodulin functions as a cofactor in the thrombin-induced activation of protein C in the anticoagulant pathway by forming a 1:1 stoichiometric complex with thrombin. Thrombomodulin also regulates C3b inactivation by factor I. Mutations in the thrombomodulin gene have also been reported to be associated with atypical hemolytic-uremic syndrome.

    Referências
  • Dzionek A, et al. (2002) Plasmacytoid dendritic cells: from specific surface markers to specific cellular functions. Hum Immunol. 63(12):1133-48.
  • Dzionek A, et al. (2000) BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood. J Immunol. 165(11):6037-46.
  • Wen DZ, et al. (1987) Human thrombomodulin: complete cDNA sequence and chromosome localization of the gene. Biochemistry. 26(14):4350-7.
  • Size / Price
    Catálogo: RG80348-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"