Encomenda rápida

Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Ratazana SYNJ2BP Informações sobre o produto de clone de cDNA
Tamanho de cDNA:438bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus synaptojanin 2 binding protein with N terminal Flag tag.
Sinónimo de gene:Omp25
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG81604-ACG$225
Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG81604-ACR$225
Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG81604-ANG$225
Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG81604-ANR$225
Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG81604-CF$195
Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG81604-CH$195
Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG81604-CM$195
Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG81604-CY$195
Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de expressão)RG81604-G$75
Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG81604-NF$195
Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG81604-NH$195
Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG81604-NM$195
Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG81604-NY$195
Ratazana SYNJ2BP clonagem de ADN ou de clonagem do gene (vector de clonagem)RG81604-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: RG81604-NF
Preço de catálogo: 
Preço:      (You Save: )
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.