Encomenda rápida

Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat SUMO1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:306bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) with N terminal HA tag.
Sinónimo de gene:Sumo1
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80486-ACG$225
Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80486-ACR$225
Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG80486-ANG$225
Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG80486-ANR$225
Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80486-CF$195
Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80486-CH$195
Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80486-CM$195
Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80486-CY$195
Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80486-NF$195
Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80486-NH$195
Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80486-NM$195
Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80486-NY$195
Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de expressão)RG80486-U$75
Ratazana SUMO1/SUMO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80486-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Small ubiquitin-like modifier protein (SUMO) modification is a highly dynamic process, catalyzed by SUMO-specific activating (E1), conjugating (E2) and ligating (E3) enzymes, and reversed by a family of SUMO-specific proteases (SENPs). Small ubiquitin-like modifier 1 (SUMO1) is a member of the superfamily of ubiquitin-like proteins. Despite its structural similarity with ubiquitin, SUMO1 does not seem to play any role in protein degradation. SUMO1 plays an important role in modulation of NOX activity required for ROS generation. SUMO1 haploinsufficiency results in cleft lip and palate in animal models. SUMO1 gene variation in human non-syndromic cleft lip with or without cleft palate (NSCLP) development. SUMO-1 may be useful as a novel target for therapy in oral squamous cell carcinoma (SCC) as well as a clinical indicator for tumor recurrence together with Mdm2.

  • Kim HJ, et al. (2011) SUMO1 attenuates stress-induced ROS generation by inhibiting NADPH oxidase 2. Biochem Biophys Res Commun. 410(3): 555-62.
  • Zuo Y, et al. (2009) Small ubiquitin-like modifier protein-specific protease 1 and prostate cancer. Asian J Androl. 11(1): 36-8.
  • Song T, et al. (2008) SUMO1 polymorphisms are associated with non-syndromic cleft lip with or without cleft palate. Biochem Biophys Res Commun. 377(4): 1265-8.
  • Katayama A, et al. (2007) Overexpression of small ubiquitin-related modifier-1 and sumoylated Mdm2 in oral squamous cell carcinoma: possible involvement in tumor proliferation and prognosis. Int J Oncol. 31(3): 517-24.
  • Size / Price
    Catálogo: RG80486-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.