Encomenda rápida

Ratazana CD98/SLC3A2/4F2HC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat SLC3A2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1584bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 with N terminal His tag.
Sinónimo de gene:Mdu1, Slc3a2
Local de restrição:HindIII + XbaI (6kb + 1.67kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 804G/T not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Rat SLC3A2 Gene Plasmid Map
Rat SLC3A2 ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazana CD98/SLC3A2/4F2HC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Product nameProduct name

4F2 cell-surface antigen heavy chain, also known as 4F2 heavy chain antigen, Lymphocyte activation antigen 4F2 large subunit, CD98, SLC3A2 and MDU1, is a single-pass type I I membrane protein which belongs to the SLC3A transporter family. SLC3A2 / MDU1 is expressed ubiquitously in all tissues tested with highest levels detected in kidney, placenta and testis and weakest level in thymus. During gestation, expression in the placenta is significantly stronger at full-term than at the mid-trimester stage. SLC3A2 / MDU1 is expressed in HUVECS and at low levels in resting peripheral blood T-lymphocytes and quiescent fibroblasts. It is expressed in fetal liver and in the astrocytic process of primary astrocytic gliomas. SLC3A2 / MDU1 is also expressed in retinal endothelial cells and in the intestinal epithelial cell line Caco2-BBE. SLC3A2 / MDU1 is required for the function of light chain amino-acid transporters. It involved in sodium-independent, high-affinity transport of large neutral amino acids such as phenylalanine, tyrosine, leucine, arginine and tryptophan. SLC3A2 / MDU1 is involved in guiding and targeting of LAT1 and LAT2 to the plasma membrane. When associated with SLC7A6 or SLC7A7, SLC3A2 / MDU1 acts as an arginine/glutamine exchanger, following an antiport mechanism for amino acid transport, influencing arginine release in exchange for extracellular amino acids. SLC3A2 / MDU1 plays a role in nitric oxide synthesis in human umbilical vein endothelial cells (HUVECs) via transport of L-arginine. It is required for normal and neoplastic cell growth. When associated with SLC7A5/LAT1, SLC3A2 / MDU1 is also involved in the transport of L-DOPA across the blood-brain barrier, and that of thyroid hormones triiodothyronine (T3) and thyroxine (T4) across the cell membrane in tissues such as placenta.

  • Torrents D. et al., 1998, J Biol Chem. 273: 32437-45.
  • Pfeiffer R. et al., 1999, EMBO J. 18: 49-57.
  • Broeer A. et al., 2000, Biochem J. 349: 787-95.
  • Yanagida O. et al., 2001, Biochim Biophys Acta. 1514: 291-302.
  • Broeer A. et al., 2001, Biochem J. 355: 725-31.
  • Fort J. et al., 2007, J Biol Chem. 282: 31444-52.
  • Mayya V. et al., 2009, Sci Signal. 2: RA46-RA46.
  • Size / Price
    Catálogo: RG80339-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    • Rat SLC3A2 ORF mammalian expression plasmid, N-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.