Encomenda rápida

Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Ratazana SLC35A4 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_147140.2
Tamanho de cDNA:975bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus solute carrier family 35, member A4.
Sinónimo de gene:Plrr-4,Plrr4
Espécie:Rat
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SLC35A4 qPCR primers for gene expression analysis, RP301001 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG81037-ACG$225
Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG81037-ACR$225
Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG81037-ANG$225
Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG81037-ANR$225
Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG81037-CF$195
Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG81037-CH$195
Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG81037-CM$195
Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG81037-CY$195
Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG81037-NF$195
Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG81037-NH$195
Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG81037-NM$195
Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG81037-NY$195
Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de expressão)RG81037-U$75
Ratazana SLC35A4 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG81037-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: RG81037-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"