After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazana SFTPD/SP-D clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat SFTPD Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_012878.2
Tamanho de cDNA:1125bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus surfactant protein D.
Sinónimo de gene:SPD, SP-D, Sftpd
Espécie:Rat
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fundo

Surfactant pulmonary-associated protein D, also known as SFTPD and SP-D, is a member of the collectin family of C-type lectins that is synthesized in many tissues including respiratory epithelial cells in the lung, and contains one C-type lectin domain and one collagen-like domain. The polymorphic variation in the N-terminal domain of the SP-D molecule influences oligomerization, function, and the concentration of the molecule in serum. SFTPD is produced primarily by alveolar type II cells and nonciliated bronchiolar cells in the lung and is constitutively secreted into the alveoli where it influences surfactant homeostasis, effector cell functions, and host defense. It is upregulated in a variety of inflammatory and infectious conditions including Pneumocystis pneumonia and asthma. SFTPD is humoral molecules of the innate immune system, and is considered a functional candidate in chronic periodontitis. Besides it is involved in the development of acute and chronic inflammation of the lung. Several human lung diseases are characterized by decreased levels of bronchoalveolar SFTPD. Thus, recombinant SFTPD has been proposed as a therapeutical option for cystic fibrosis, neonatal lung disease and smoking-induced emphysema. Furthermore, SFTPD serum levels can be used as disease activity markers for interstitial lung diseases.

Referências
  • Leth-Larsen R, et al. (2005) A common polymorphism in the SFTPD gene influences assembly, function, and concentration of surfactant protein D. J Immunol. 174(3): 1532-8.
  • Moran AP, et al. (2005) Role of surfactant protein D (SP-D) in innate immunity in the gastric mucosa: evidence of interaction with Helicobacter pylori lipopolysaccharide. J Endotoxin Res. 11(6): 357-62.
  • Hartl D, et al. (2006) Surfactant protein D in human lung diseases. Eur J Clin Invest. 36(6): 423-35.
  • Krueger M, et al. (2006) Amino acid variants in Surfactant protein D are not associated with bronchial asthma. Pediatr Allergy Immunol. 17(1): 77-81.
  • Glas J, et al. (2008) Increased plasma concentration of surfactant protein D in chronic periodontitis independent of SFTPD genotype: potential role as a biomarker. Tissue Antigens. 72(1): 21-8.
  • Size / Price
    Catálogo: RG80256-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"