Encomenda rápida

Ratazana Semaphorin 4D/SEMA4D/CD100 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat SEMA4D Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2589bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D with N terminal His tag.
Sinónimo de gene:Sema4d
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazana Semaphorin 4D/SEMA4D/CD100 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazana Semaphorin 4D/SEMA4D/CD100 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80320-ACG$325
Ratazana Semaphorin 4D/SEMA4D/CD100 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80320-ACR$325
Ratazana Semaphorin 4D/SEMA4D/CD100 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80320-CF$295
Ratazana Semaphorin 4D/SEMA4D/CD100 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80320-CH$295
Ratazana Semaphorin 4D/SEMA4D/CD100 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80320-CM$295
Ratazana Semaphorin 4D/SEMA4D/CD100 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80320-CY$295
Ratazana Semaphorin 4D/SEMA4D/CD100 clonagem de ADN ou de clonagem do gene (vector de expressão)RG80320-G$75
Ratazana Semaphorin 4D/SEMA4D/CD100 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80320-NF$295
Ratazana Semaphorin 4D/SEMA4D/CD100 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80320-NH$295
Ratazana Semaphorin 4D/SEMA4D/CD100 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80320-NM$295
Ratazana Semaphorin 4D/SEMA4D/CD100 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80320-NY$295
Ratazana Semaphorin 4D/SEMA4D/CD100 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80320-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: RG80320-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.