After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat S100A11 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:297bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus S100 calcium binding protein A11 with N terminal HA tag.
Sinónimo de gene:S100a11
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80466-ACG$225
Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80466-ACR$225
Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG80466-ANG$225
Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG80466-ANR$225
Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80466-CF$195
Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80466-CH$195
Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80466-CM$195
Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80466-CY$195
Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80466-NF$195
Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80466-NH$195
Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80466-NM$195
Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80466-NY$195
Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de expressão)RG80466-U$75
Ratazana S100A11 / S100C clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80466-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Protein S100-A11, also known as S100 calcium-binding protein A11, S100A11 and MLN70, is a member of the S-100 family. S100A11 is widely expressed in multiple tissues, and is located in cytoplasm, nucleus, and even cell periphery. S100A11 exists as a non-covalent homodimer with an antiparallel conformation. Ca(2+) binding to S100A11 would trigger conformational changes which would expose the hydrophobic cleft of S100A11 and facilitate its interaction with target proteins. As a dual cell growth mediator, S100A11 acts as either a tumor suppressor or promoter in many different types of tumors and would play respective roles in influencing the proliferation of the cancer cells. In the nucleus, S100A11 suppresses the growth of keratinocytes through p21 (CIP1/WAF1) activation and induces cell differentiation. S100A11 is also a novel diagnostic marker in breast carcinoma.

  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Ohuchida K. et al., 2006, Clin Cancer Res  12 (18): 5417-22.
  • Kouno T. et al., 2008, J Pept Sci. 14 (10): 1129-38.
  • He H. et al., 2009, Cell Biochem Biophys 55 (3): 117-26.
  • Liu XG. et al., 2010, Oncol Rep. 23 (5): 1301-8.
  • Size / Price
    Catálogo: RG80466-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.