After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat RGD1306063 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001106026.2
Tamanho de cDNA:381bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus similar to HT021.
Sinónimo de gene:RGD1306063
Espécie:Rat
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG81048-ACG$225
Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG81048-ACR$225
Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG81048-ANG$225
Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG81048-ANR$225
Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG81048-CF$195
Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG81048-CH$195
Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG81048-CM$195
Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG81048-CY$195
Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG81048-NF$195
Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG81048-NH$195
Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG81048-NM$195
Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG81048-NY$195
Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de expressão)RG81048-U$75
Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG81048-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: RG81048-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"