Encomenda rápida

Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Ratazana RGD1306063 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001106026.2
    Tamanho de cDNA:381bp
    Descrição de cDNA:Full length Clone DNA of Rattus norvegicus similar to HT021.
    Sinónimo de gene:RGD1306063
    Espécie:Rat
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RGD1306063 qPCR primers for gene expression analysis, RP301012 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG81048-ACG$325
    Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG81048-ACR$325
    Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG81048-ANG$325
    Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG81048-ANR$325
    Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG81048-CF$295
    Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG81048-CH$295
    Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG81048-CM$295
    Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG81048-CY$295
    Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG81048-NF$295
    Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG81048-NH$295
    Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG81048-NM$295
    Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG81048-NY$295
    Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de expressão)RG81048-U$75
    Ratazana RGD1306063 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG81048-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: RG81048-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"