Reg3A cDNA ORF Clone, Rat, C-His tag

Cat: RG80258-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Reg3A Reagents

CRO Services

Product recommended


All Reg3A Reagents

Reg3A cDNA ORF Clone, Rat, C-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
525 bp
Description
Full length Clone DNA of Rat regenerating islet-derived 3 alpha with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Reg3A cDNA ORF Clone, Rat, C-His tag Alternative Names

Pap2 cDNA ORF Clone, Rat;Reg3 cDNA ORF Clone, Rat;REG3A cDNA ORF Clone, Rat

Reg3A Background Information

Regenerating islet-derived protein 3-alpha, also known as Regenerating islet-derived protein III-alpha, REG-3-alpha, REG3A, and HIP, is secreted protein which contains one C-type lectin domain. REG3A is constitutively expressed in intestine, and is a pancreatic secretory protein that may be involved in cell proliferation or differentiation. It is overexpressed during the acute phase of pancreatitis and in some patients with chronic pancreatitis. REG3A and REG1A proteins are both involved in liver and pancreatic regeneration and proliferation. REG3A is also a stress protein involved in the control of bacterial proliferation. REG3A is down-regulated in most primary human gastric cancer cells, and might be useful in the diagnosis of gastric cancer. Additionally, REG3A is a target of beta-catenin signaling in Huh7 hepatoma cells. The REG1A and REG3A are downstream targets of the Wnt pathway during liver tumorigenesis.

Full Name
regenerating family member 3 alpha
References
  • Cavard C, et al. (2006) Overexpression of regenerating islet-derived 1 alpha and 3 alpha genes in human primary liver tumors with beta-catenin mutations. Oncogene. 25(4): 599-608.
  • Choi B, et al. (2007) Downregulation of regenerating islet-derived 3 alpha (REG3A) in primary human gastric adenocarcinomas. Exp Mol Med. 39(6): 796-804.
  • Reg3A cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Reg3A cDNA ORF Clone in Cloning Vector, Rat RG80258-G
    Reg3A cDNA ORF Clone, Rat, untagged RG80258-UT
    Reg3A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80258-ACGLN
    Reg3A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80258-ACG
    Reg3A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80258-ACR
    Reg3A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80258-CF
    Reg3A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80258-NF
    Reg3A cDNA ORF Clone, Rat, N-His tag RG80258-NH
    Reg3A cDNA ORF Clone, Rat, C-HA tag RG80258-CY
    Reg3A cDNA ORF Clone, Rat, N-HA tag RG80258-NY
    Reg3A cDNA ORF Clone, Rat, C-Myc tag RG80258-CM
    Reg3A cDNA ORF Clone, Rat, N-Myc tag RG80258-NM
    Reg3A qPCR Primer Pairs, Rat RP300243

    Reg3A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Reg3A cDNA ORF Clone, Mouse, untagged MG50185-UT
    Reg3A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50185-ACG
    Reg3A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50185-ACGLN
    Reg3A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50185-ACR
    Reg3A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50185-CF
    Reg3A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50185-NF
    Reg3A cDNA ORF Clone, Mouse, C-His tag MG50185-CH
    Reg3A cDNA ORF Clone, Mouse, N-His tag MG50185-NH
    Reg3A cDNA ORF Clone, Mouse, C-HA tag MG50185-CY
    Reg3A cDNA ORF Clone, Mouse, N-HA tag MG50185-NY
    Reg3A cDNA ORF Clone, Mouse, C-Myc tag MG50185-CM
    Reg3A cDNA ORF Clone, Mouse, N-Myc tag MG50185-NM
    Reg3A qPCR Primer Pairs, Mouse MP200215

    Reg3A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Reg3A cDNA ORF Clone in Cloning Vector, Human HG11235-M
    Reg3A cDNA ORF Clone, Human, untagged HG11235-UT
    Reg3A cDNA ORF Clone, Human, C-GFPSpark® tag HG11235-ACG
    Reg3A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11235-ACGLN
    Reg3A cDNA ORF Clone, Human, N-GFPSpark® tag HG11235-ANG
    Reg3A cDNA ORF Clone, Human, C-OFPSpark® tag HG11235-ACR
    Reg3A cDNA ORF Clone, Human, N-OFPSpark® tag HG11235-ANR
    Reg3A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11235-CF
    Reg3A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11235-NF
    Reg3A cDNA ORF Clone, Human, C-His tag HG11235-CH
    Reg3A cDNA ORF Clone, Human, N-His tag HG11235-NH
    Reg3A cDNA ORF Clone, Human, C-HA tag HG11235-CY
    Reg3A cDNA ORF Clone, Human, N-HA tag HG11235-NY
    Reg3A cDNA ORF Clone, Human, C-Myc tag HG11235-CM
    Reg3A cDNA ORF Clone, Human, N-Myc tag HG11235-NM
    Reg3A qPCR Primer Pairs, Human HP101179
    info info
    添加购物车成功! 添加购物车失败!