After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Rat PROM1 ORF mammalian expression plasmid, N-His tag

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat PROM1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001110137.1
Tamanho de cDNA:2481bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus prominin 1 with N terminal His tag.
Sinónimo de gene:Prom, CD133, MGC156650, Prom1
Espécie:Rat
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fundo

CD133, also known as PROM1 and Prominin 1, is a pentaspan transmembrane glycoprotein which belongs to the prominin family. It localizes to membrane protrusions and is often expressed on adult stem cells. CD133 is known to play a role in maintaining stem cell properties by suppressing differentiation. CD133 binds cholesterol in cholesterol-containing plasma membrane microdomains. It is proposed to play a role in apical plasma membrane organization of epithelial cells. CD133 is also involved in regulation of MAPK and Akt signaling pathways. Mutations in PROM1 gene have been shown to result in retinitis pigmentosa and Stargardt disease. PROM1 gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Expression of this gene is also associated with several types of cancer.

Referências
  • Corbeil D. et al., 2001, Biochem Biophys Res Commun. 285 (4): 939-44.
  • Horn PA. et al., 1999, Blood. 93 (4): 1435-37.
  • Sanai N. et al., 2005, N Engl J Med. 353 (8): 811-22.
  • Size / Price
    Catálogo: RG80324-NH
    Preço de catálogo:   (Save )
    Preço:      [How to order]
    Disponibilidade
     Instruções de envio
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"