Cyclophilin B cDNA ORF Clone, Rat, untagged

Price:
Size:
Number:

Cyclophilin B cDNA ORF Clone, Rat, untagged: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
627 bp
Description
Full length Clone DNA of Rat peptidylprolyl isomerase B.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Cyclophilin B Background Information

PPIB is identified as a candidate gene for OI-IX.Osteogenesis imperfecta (OI) is an inherited disorder of connective tissue typically caused by defects in either COL1A1 or COL1A2. A number of other genes causative of this disorder have been found, including PPIB, which forms one subunit of the prolyl 3-hydroxylase enzyme complex.Patients with OI caused by PPIB mutation should have appropriate early and regular management of their hearing.
Full Name
peptidylprolyl isomerase B (cyclophilin B)
Add to Cart Successfully Add to Cart Failed