After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana PEAR1/MEGF12 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat PEAR1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001134959.1
Tamanho de cDNA:3102bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus platelet endothelial aggregation receptor 1.
Sinónimo de gene:MGC188434, RGD1305653, Pear1
Espécie:Rat
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"