After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat NUDT5 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001007733.1
Tamanho de cDNA:660bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus nudix (nucleoside diphosphate linked moiety X)-type motif 5 with C terminal Myc tag.
Sinónimo de gene:Nudt5
Espécie:Rat
Vetor:pCMV3-C-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG81109-ACG$225
Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG81109-ACR$225
Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG81109-ANG$225
Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG81109-ANR$225
Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG81109-CF$195
Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG81109-CH$195
Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG81109-CM$195
Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG81109-CY$195
Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG81109-NF$195
Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG81109-NH$195
Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG81109-NM$195
Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG81109-NY$195
Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de expressão)RG81109-U$75
Ratazana ADP-sugar Pyrophosphatase/NUDT5 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG81109-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

ADP-sugar Pyrophosphatase, also known as NUDT5, eliminates toxic nucleotide derivatives from the cell and regulate the levels of important signaling nucleotides and their metabolites. NUDT5 functions as a MutT-related protein and catalyzes the hydrolysis of 8-oxoGDP to 8-oxoGMP, thereby preventing misincorporation of 8-oxoGua into RNA. NUDT5 may play significant roles in regulating the G1-S transition in mammalian cells. It can also hydrolyze other nucleotide sugars with low activity.

Referências
  • Ishibashi T. et al., 2004, EMBO Rep. 4 (5): 479-8.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Rush J. et al., 2005, Nat Biotechnol. 23 (1): 94-101.
  • Kamiya H. et al., 2009, DNA Repair. 8 (10): 1250-4.
  • Size / Price
    Catálogo: RG81109-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"