After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana CD73/NT5E clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat NT5E Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_021576.2
Tamanho de cDNA:1731bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus 5' nucleotidase, ecto with N terminal His tag.
Sinónimo de gene:Nt5, CD73, MGC112615, Nt5e
Espécie:Rat
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fundo

5'-nucleotidase, also known as NT5E, NTE, and CD73, is a cell membrane protein which belongs to the 5'-nucleotidase family. CD73 is a glycosyl phosphatidylinositol (GPI) anchored purine salvage enzyme expressed on the surface of human T and B lymphocytes. CD73 catalyzes the conversion of purine and pyrimidine ribo- and deoxyribonucleoside monophosphates to the corresponding nucleosides. CD73 serves as a costimulatory molecule in activating T cells. CD73 generated adenosine functions in cell signalling in many physiologic systems, including intestinal epithelium, ischemic myocardium, and cholinergic synapses. CD73 might mediate lymphocyte-stromal cell interactions or condition the local microenvironment to facilitate lymphocyte development and/or function. In CD73-depleted cells, surface levels of the leukocyte adhesion molecules ICAM-1, VCAM-1 and E-selectin increase. CD73 produces extracellular adenosine, which then acts on G protein-coupled purigenic receptors to induce cellular responses. CD73 has also been reported to regulate expression of pro-inflammatory molecules in mouse endothelium.

Referências
  • Resta R. et al., 1997, Cell Signal. 9 (2): 131-9.
  • Yamashita Y. et al., 1998, Eur J Immunol. 28 (10): 2981-90.
  • Louis NA. et al., 2008, J Immunol. 180 (6): 4246-55.
  • Grünewald JK. et al., 2010, J Inflamm. 7 (1): 10.
  • Size / Price
    Catálogo: RG80335-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"