After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazana NCR1 / NK-p46 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat NCR1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_057199.1
Tamanho de cDNA:978bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus natural cytotoxicity triggering receptor 1 with C terminal HA tag.
Sinónimo de gene:Ly94, Nkp46, KILR-1, Nk-p46, Ncr1
Espécie:Rat
Vetor:pCMV3-C-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fundo

NCR1, also known as NK-p46 and CD335, is a natural cytotoxicity receptor(NCR). NCRs are type I transmembrane proteins with 1-2 extracellular immunoglobulin domains, a transmembrane domain containing a positively charged amino acid residue, and a short cytoplasmic tail. All are expressed almost exclusively by NK cells and play a major role in triggering NK-mediated killing of most tumor cell lines. NKp46 has two extracellular Ig-like domains followed by a ~40 residue stalk region, a type I transmembrane domain, and a short cytoplasmic tail. NKp46 has been implicated in NK cell-mediated lysis of several autologous tumor cells, pathogen-infected cell lines and mononuclear phagocytes infected with an intracellular bacterium.

Referências
  • Carbone E, et al. (2005) HLA class I, NKG2D, and natural cytotoxicity receptors regulate multiple myeloma cell recognition by natural killer cells. Blood. 105(1):251-8.
  • Sivori S, et al. (1997) p46, a Novel Natural Killer Cell-specific Surface Molecule That Mediates Cell Activation. J Exp Med. 186(7):1129-36.
  • Biassoni R, et al. (2004) Human natural killer cell receptors: insights into their molecular function and structure. J Cell Mol Med. 7(4):376-87.
  • Size / Price
    Catálogo: RG80378-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"