Encomenda rápida

Text Size:AAA

Ratazana TNF-beta/TNFSF1/Lymphotoxin alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat LTA Informações sobre o produto de clone de cDNA
Tamanho de cDNA:609bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus lymphotoxin alpha (TNF superfamily, member 1) with N terminal Flag tag.
Sinónimo de gene:Tnfb, Tnfsf1, Lta
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazana TNF-beta/TNFSF1/Lymphotoxin alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Ratazana TNF-beta/TNFSF1/Lymphotoxin alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80147-ACG$225
Ratazana TNF-beta/TNFSF1/Lymphotoxin alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80147-ACR$225
Ratazana TNF-beta/TNFSF1/Lymphotoxin alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80147-CF$195
Ratazana TNF-beta/TNFSF1/Lymphotoxin alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80147-CH$195
Ratazana TNF-beta/TNFSF1/Lymphotoxin alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80147-CM$195
Ratazana TNF-beta/TNFSF1/Lymphotoxin alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80147-CY$195
Ratazana TNF-beta/TNFSF1/Lymphotoxin alpha clonagem de ADN ou de clonagem do gene (vector de expressão)RG80147-G$75
Ratazana TNF-beta/TNFSF1/Lymphotoxin alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80147-NF$195
Ratazana TNF-beta/TNFSF1/Lymphotoxin alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80147-NH$195
Ratazana TNF-beta/TNFSF1/Lymphotoxin alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80147-NM$195
Ratazana TNF-beta/TNFSF1/Lymphotoxin alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80147-NY$195
Ratazana TNF-beta/TNFSF1/Lymphotoxin alpha clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80147-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Lymphotoxin-alpha, also known as LT-alpha, TNF-beta, Tumor necrosis factor ligand superfamily member 1, LTA TNFSF1 and TNFB, is a secreted protein which belongs to the tumor necrosis factor family. TNF-beta/TNFSF1/Lymphotoxin alpha is a highly inducible, secreted, and exists as homotrimeric molecule. It is a cytokine that in its homotrimeric form binds to TNFRSF1A / TNFR1, TNFRSF1B / TNFBR and TNFRSF14 / HVEM. In its heterotrimeric form with LTB, TNF-beta/TNFSF1/Lymphotoxin alpha binds to TNFRSF3 / LTBR. Lymphotoxin is produced by lymphocytes and cytotoxic for a wide range of tumor cells. TNF-beta/TNFSF1/Lymphotoxin alpha forms heterotrimers with lymphotoxin-beta which anchors lymphotoxin-alpha to the cell surface. It mediates a large variety of inflammatory, immunostimulatory, and antiviral responses. TNF-beta/TNFSF1/Lymphotoxin alpha is also involved in the formation of secondary lymphoid organs during development and plays a role in apoptosis. Genetic variations in TNF-beta/TNFSF1/Lymphotoxin alpha are a cause of susceptibility psoriatic arthritis which is an inflammatory, seronegative arthritis associated with psoriasis. It is a heterogeneous disorder ranging from a mild, non-destructive disease to a severe, progressive, erosive arthropathy.

  • Messer G, et al. (1991) Polymorphic structure of the tumor necrosis factor (TNF) locus: an NcoI polymorphism in the first intron of the human TNF-beta gene correlates with a variant amino acid in position 26 and a reduced level of TNF-beta production. J Exp Med. 173(1): 209-19.
  • Banner DW, et al. (1993) Crystal structure of the soluble human 55 kd TNF receptor-human TNF beta complex: implications for TNF receptor activation. Cell. 73(3): 431-45.
  • Picarella DE, et al. (1993) Transgenic tumor necrosis factor (TNF)-alpha production in pancreatic islets leads to insulitis, not diabetes. Distinct patterns of inflammation in TNF-alpha and TNF-beta transgenic mice. J Immunol. 150(9): 4136-50.
  • Size / Price
    Catálogo: RG80147-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.