After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana spleen Proteína 1 precursor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat LOC171573 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:300bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus spleen protein 1 precursor with N terminal Myc tag.
Sinónimo de gene:Sslp1
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazana spleen Proteína 1 precursor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Ratazana spleen Proteína 1 precursor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80732-ACG$225
Ratazana spleen Proteína 1 precursor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80732-ACR$225
Ratazana spleen Proteína 1 precursor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80732-CF$195
Ratazana spleen Proteína 1 precursor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80732-CH$195
Ratazana spleen Proteína 1 precursor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80732-CM$195
Ratazana spleen Proteína 1 precursor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80732-CY$195
Ratazana spleen Proteína 1 precursor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80732-NF$195
Ratazana spleen Proteína 1 precursor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80732-NH$195
Ratazana spleen Proteína 1 precursor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80732-NM$195
Ratazana spleen Proteína 1 precursor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80732-NY$195
Ratazana spleen Proteína 1 precursor clonagem de ADN ou de clonagem do gene (vector de expressão)RG80732-U$75
Ratazana spleen Proteína 1 precursor clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80732-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: RG80732-NM
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.