After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Rat LMAN2 natural ORF mammalian expression plasmid

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat LMAN2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001115024.2
Tamanho de cDNA:1077bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus lectin, mannose-binding 2.
Sinónimo de gene:Vip36
Espécie:Rat
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Referências
  • Nawa D, et al. (2007) Stable interaction of the cargo receptor VIP36 with molecular chaperone BiP. Glycobiology. 17(9): 913-21.
  • Shimada O, et al. (2003) Localization of VIP36 in the post-Golgi secretory pathway also of rat parotid acinar cells. J Histochem Cytochem. 51(8): 1057-63.
  • Hara-Kuge S, et al. (1999) Vesicular-integral membrane protein, VIP36, recognizes high-mannose type glycans containing alpha1--2 mannosyl residues in MDCK cells. Glycobiology. 9(8): 833-9.
  • Fullekrug J, et al. (1999) VIP36 localisation to the early secretory pathway. J Cell Sci. 112 ( Pt 17): 2813-21.
  • Size / Price
    Catálogo: RG81022-UT
    Preço de catálogo:   (Save )
    Preço:      [How to order]
    Disponibilidade2-3 weeks
     Instruções de envio
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"