After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat LGALS4 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_012975.1
Tamanho de cDNA:975bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus lectin, galactoside-binding, soluble, 4.
Sinónimo de gene:L-36, L36LBI, Lgals4
Espécie:Rat
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80253-ACG$225
Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80253-ACR$225
Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG80253-ANG$225
Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG80253-ANR$225
Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80253-CF$195
Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80253-CH$195
Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80253-CM$195
Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80253-CY$195
Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de expressão)RG80253-G$75
Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80253-NF$195
Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80253-NH$195
Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80253-NM$195
Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80253-NY$195
Ratazana Galectin-4/LGALS4 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80253-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: RG80253-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"