After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana LAMP2/CD107b clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat LAMP2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1236bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus lysosomal-associated membrane protein 2 with C terminal HA tag.
Sinónimo de gene:Lamp2
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

LAMP2 (Lysosomal-associated membrane protein 2), also known as CD107b (Cluster of Differentiation 107b), is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. In human, LAMP2, the causative gene of Danon disease, located on chromosome Xq24, encodes the lysosome-associated membrane protein-2 (LAMP-2). LAMP-2 deficiency, or Danon disease, is a rare X-linked lysosomal disease characterized by cardiomyopathy, vacuolar myopathy, and mental retardation. LAMP2 cardiomyopathy is an X-linked and highly progressive myocardial storage disorder associated with diminished survival, which clinically resembles sarcomeric hypertrophic cardiomyopathy.

  • Maron BJ, et al. (2010) Profound left ventricular remodeling associated with LAMP2 cardiomyopathy. Am J Cardiol. 106(8): 1194-6.
  • Di Blasi C, et al. (2008) Danon disease: a novel LAMP2 mutation affecting the pre-mRNA splicing and causing aberrant transcripts and partial protein expression. Neuromuscul Disord. 18(12): 962-6.
  • Echaniz-Laguna A, et al. (2006) Novel Lamp-2 gene mutation and successful treatment with heart transplantation in a large family with Danon disease. Muscle Nerve. 33(3): 393-7.
  • Size / Price
    Catálogo: RG80368-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.