Encomenda rápida

Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Ratazana ITGB3 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_153720.1
Tamanho de cDNA:2364bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus integrin, beta 3 with N terminal His tag.
Sinónimo de gene:Itgb3
Espécie:Rat
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ITGB3 qPCR primers for gene expression analysis, RP300285 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80312-ACG$245
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80312-ACR$245
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80312-CF$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80312-CH$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80312-CM$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80312-CY$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de expressão)RG80312-G$75
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80312-NF$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80312-NH$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80312-NM$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80312-NY$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80312-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: RG80312-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"