After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat ITGB3 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2364bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus integrin, beta 3 with C terminal His tag.
Sinónimo de gene:Itgb3
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80312-ACG$245
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80312-ACR$245
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80312-CF$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80312-CH$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80312-CM$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80312-CY$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de expressão)RG80312-G$75
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80312-NF$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80312-NH$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80312-NM$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80312-NY$215
Ratazana CD61/Integrin beta 3/ITGB3 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80312-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: RG80312-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.