Encomenda rápida

Ratazana Integrin alpha 4/CD49d/ITGA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Ratazana ITGA4 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:3111bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus integrin, alpha 4 with C terminal His tag.
Sinónimo de gene:Itga4
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
( We provide with ITGA4 qPCR primers for gene expression analysis, RP300268 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazana Integrin alpha 4/CD49d/ITGA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazana Integrin alpha 4/CD49d/ITGA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80291-ACG$325
Ratazana Integrin alpha 4/CD49d/ITGA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80291-ACR$325
Ratazana Integrin alpha 4/CD49d/ITGA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80291-CF$295
Ratazana Integrin alpha 4/CD49d/ITGA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80291-CH$295
Ratazana Integrin alpha 4/CD49d/ITGA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80291-CM$295
Ratazana Integrin alpha 4/CD49d/ITGA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80291-CY$295
Ratazana Integrin alpha 4/CD49d/ITGA4 clonagem de ADN ou de clonagem do gene (vector de expressão)RG80291-G$75
Ratazana Integrin alpha 4/CD49d/ITGA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80291-NF$295
Ratazana Integrin alpha 4/CD49d/ITGA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80291-NH$295
Ratazana Integrin alpha 4/CD49d/ITGA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80291-NM$295
Ratazana Integrin alpha 4/CD49d/ITGA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80291-NY$295
Ratazana Integrin alpha 4/CD49d/ITGA4 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80291-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.