Encomenda rápida

Ratazana IL-27 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat IL27 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:705bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus interleukin 27 with N terminal Flag tag.
Sinónimo de gene:RGD1561420, Il27
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

IL-27 protein is a member of the IL-6 superfamily, which is expressed on monocytes, endothelial cells and dendritic cells. IL-27 protein is also referred as the IL-12 p35-related protein, p28, is one subunit of a heterodimeric cytokine complex, and associates with another subunit EBI3 (EBV-induced gene 3), an IL-12 p40-related protein (IL-27B). IL-27 protein is an early product of activated antigen-presenting cells and drives rapid clonal expansion of naive CD4(+) T cells and plays a role in the early regulation of Th1 cells initiation which drives efficient adaptive immune response. IL-27 protein has an antiproliferative activity on melanomas through WSX-1/STAT1 signaling. Thus, IL-27 protein may be an attractive candidate as an antitumor agent applicable to cancer immunotherapy.

  • Hisada M, et al. (2004) Potent antitumor activity of interleukin-27. Cancer Res. 64(3): 1152-6.
  • Larousserie F, et al. (2005) Analysis of interleukin-27 (EBI3/p28) expression in Epstein-Barr virus- and human T-cell leukemia virus type 1-associated lymphomas: heterogeneous expression of EBI3 subunit by tumoral cells. Am J Pathol. 166(4): 1217-28.
  • Seita J, et al. (2008) Interleukin-27 directly induces differentiation in hematopoietic stem cells. Blood. 111(4): 1903-12.
  • Size / Price
    Catálogo: RG80201-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.