After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazana IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat IL17RB Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001107290.1
Tamanho de cDNA:1065bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus interleukin 17 receptor B with N terminal Flag tag.
Sinónimo de gene:Il17rb, Il17rb_predicted
Espécie:Rat
Vetor:pCMV3-SP-N-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazana IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Ratazana IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80188-ACG$225
Ratazana IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80188-ACR$225
Ratazana IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80188-CF$195
Ratazana IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80188-CH$195
Ratazana IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80188-CM$195
Ratazana IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80188-CY$195
Ratazana IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de expressão)RG80188-G$75
Ratazana IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80188-NF$195
Ratazana IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80188-NH$195
Ratazana IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80188-NM$195
Ratazana IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80188-NY$195
Ratazana IL17BR / IL17RB / IL-17 Receptor B clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80188-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Referências
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Stock P, et al.. (2009) Induction of airway hyperreactivity by IL-25 is dependent on a subset of invariant NKT cells expressing IL-17RB. J Immunol. 182(8): 5116-22.
  • Wang H, et al.. (2010) Allergen challenge of peripheral blood mononuclear cells from patients with seasonal allergic rhinitis increases IL-17RB, which regulates basophil apoptosis and degranulation. Clin Exp Allergy. 40(8): 1194-202.
  • Size / Price
    Catálogo: RG80188-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"